Darwinism

[Kyuuketsuki]

Well, I was reading through the threads and I realized that the discussion just sort of stopped with the challenge to icthus to give support of his view. I'm not sure why he never responded, or what he believes other than that he is a Christian and apparently does not believe in evolution. Honestly I am quite skeptical of macro evolution (not micro) myself

So just another f***ing creationist then?

You gotta just love this artificial distinction between micro & macro-evolution but I hate the way I see so many rational people buying into it. To the evolutionist micro and macro-evolution are one and the same the only difference (ignoring punctuated equilibrium for the moment) is time. Adaptation (what you creationists would have us call micro-evolution so that you can accept what evidence shows is happening while denying the possibility of speciation) is change, adaptation occurs all the time and as anyone (any 5 year old I imagine) could tell you one plus one equals two, something small plus something small equals something bigger. So it is with change ... small change plus small change plus small change plus small change plus (ad infinitum) results in much larger change, IOW adaptation (which even creationists, through the sheer hammering home of evidence, have been forced to admit occurs) happens and adaptation across sufficient time results in speciation. Change at the species level (given the currently accepted age of the Earth and the forces acting in the environment) is pretty much inevitable, new species will arise ... the corollary is, of course, that we really don't have to defend the idea of evolution (speciation) because if speciation is claimed NOT to happen then someone has to come up with a specific mechanism that will stop large numbers of small changes resulting in bigger changes. Until then (though I accept we have to defend against those who either wilfully or through ignorance misunderstand science and evolution) we can pretty much sit on our collective butts and say, "Show me the evidence"

IOW only a complete and utter f***ing idiot would deny the possibility of speciation WITOUT first being able to identify the mechanism which stops adaptation becoming speciation.

so I thought I would add some positive scientific evidence to the discussion for there being a creator/designer for life since that is what the challenge was for.

You'd be the very first to do so then so this ought to be good.

Though I feel that the Cambrian explosion is still a problem for evolution and yes, I did read most of the links given, frankly I got board by the third one and stopped reading. They still don't explain the extremely rapid diversity and complexity (in Geological time scale). The diversity being the large number of phyla, which is the most diversity between species and consequently requires the most amount of genetic mutation/natural selection/evolution. The Complexity goes with that, being the change from single celled organisms to complex multi-cell organisms with complex biological systems is so short a time span, nor is a proven mechanism capable of bringing it about by natural processes given, but rather assumed.

That criticism (even if valid) would qualify as a criticism of evolution and not as the positive evidence you promised us.

As for positive evidence, there are two lines of argument that I find convincing: 1) the irreducibly complex systems we see in life that defy a neo-darwininan evolution of random mutation and natural selection by blind natural processes. Things like the bacteria flagellum and the eye to name a few. Yes, I know these are hot topics, but I have yet to see anything other than a fanciful story to explain them. Even if it is a "plausible" story, that says nothing of its truth value or scientific value. Once past the story telling, the actual evidence seems to make the question even harder to explain.

Behe's irreducible complexity argument is very similar to William Paley's in that both are essentially, "if it looks designed then it must be designed" style arguments except that Behe's is somewhat more up-to-date. The problem with both arguments is the same ... Paley was premature, relying on the then current level of scientific knowledge, when he proposed that the eye could not have possibly come existed in a lesser form (we now know that the eye exists in functional "lesser" forms throughout nature and often within the same class) and Behe was premature when he proposed that a given bacterium with components comparable to an outboard motor could not function with any missing parts (bacterium have subsequently been discovered fully functional with a less than full complement of components.). Ultimately both arguments are simply arbitrary definitions of what something should can or cannot be; are absolute in nature (and if there's one thing science reflects, it is our understanding that no explanation can ever be considered beyond challenge) and are based on one individual or groups personal POV or lack of vision. Ultimately what Behe should have done is considered the possibility that an organism may have been irreducibly complex and then proceeded to attack that concept with every means at his disposal rather than, as he appeared to do, write popular science books and make himself the darling of the IDC community.

2) is the information that is found in life, specifically in the DNA of living organisms, not to mention the origin of DNA itself. I have yet to see any explanation for the information that is found in life or how random mutation and natural selection can attribute for a genetic language. And yes, I use the term language on purpose, because it has all the marks of being a language. This is after all a common terminology when describing the complexity and purpose of it, because it fits all the trademarks of being one.

I'm not one for re-inventing the wheel so I will simply post up a piece about information complexity from my own website (which I didn't author but did act as editor for). It's long so I will simply print the conclusion and hide the rest of the article ... if you want to read the way Steve (one of those dratted scientists BTW) worked it all out feel free to unhide the full article but somehow I don't think you're really interested in views that oppose your own at all:

Contrary to creationist contentions, evolution does not violate the Second Law of Thermodynamics or information theory. The evolution of organisms does not violate the Second Law of Thermodynamics any more than the growth of individual organisms violates the Second Law. The creationist contention that intelligent information in DNA somehow gets around the Second Law is erroneous. The only requirement for localized decreases in thermodynamic entropy that accompany protein synthesis or organism growth is the requirement for an open system. Organisms are open thermodynamic systems as long as they eat and breathe.

The real connection between entropy and evolution comes from looking at information theory. The kind of entropy that is important to evolution is informational entropy. Like thermodynamic entropy on a universal scale, informational entropy tends to increase over time. Since an increase in informational entropy means the complexity of a message increases, the message transmitted by DNA over generations increases in complexity. The organisms specified by the message will be more complex as a result. Evolution thus seems to be an inevitable consequence of the properties of information. Selection provides a filter that determines which of the more complex messages survive. Illustrating these trends are examples of organisms that, under specific selective pressures, experience partial or complete duplications of genes that lead to increased information content of genomes, enhanced fitness, and improved proteins. While these examples may not be as dramatic as creationists demand in asking for the "proof" of evolution that they don't really want in any case, the examples at least falsify the creationist contentions that information-increasing beneficial mutations do not exist.

---

[i]

Complexity
by
Chymyst

Introduction

One assertion that creationists have long made is that evolution contradicts the Second Law of Thermodynamics. More recently, creationists have begun to claim that evolution is also contrary to information theory. They claim that mutations can only degrade the information coded in the DNA and that even gene duplications don't really add anything new to the genome. Creationists and other designists also frequently say that the presence of complex DNA sequences in cells is evidence of intelligent design. In this article, I intend to show that all these assertions are incorrect.

Creationist Questions

1. Progressive evolution is contrary to the Second Law of Thermodynamics and is therefore scientifically impossible.
   
2. According to information theory, information in a coded message can only be lost. Therefore evolution is contrary to information theory.
   
3. Mutations only cause degradation of the genome. While a few mutations might be neutral, the most mutations are harmful and result in information loss.
   
4. Mutations cannot add anything new; they can only lead to deterioration of the coded information in the DNA.
   
5. Gene duplications do not add anything new to a genome and therefore do not add any information. The complexity of DNA sequences is evidence of intelligent design.

Abstract

• The creationist assertion that progressive evolution violates the Second Law of Thermodynamics is based on faulty statements of the Second Law and oversimplified definitions of entropy. About all the Second Law of Thermodynamics really says about living organisms is that an organism that stops eating will die.
  
• Information theory does not contradict evolution. In fact, evolution is a natural consequence of the increasing informational entropy that information theory says is inevitable in any error-prone communication system.
  
• Gene duplications, especially gene duplications that are followed by point mutations in the original gene or the duplicate copy, do represent an increase in the information content of a genome.
  
• Beneficial mutations that increase the information content of genomes have been observed in the laboratory.
  
• Random sequences of DNA are indistinguishable from highly organized sequences of DNA. Therefore complexity of DNA sequences is not evidence of intelligent design.

Discussion
Creationists have long tried to disprove evolution using the Second Law of Thermodynamics. According to creationists, the Second Law of Thermodynamics says that everything should move to a state of higher "entropy" that they define as disorder, randomness, or chaos. Some creationists will even claim that evolution is totally unscientific because it contradicts this inviolate principle. However, if the oversimplified statement of the Second Law and the inaccurate definition of entropy they use were correct, then ice could not form. If the Second Law really said what creationists often say it does, no organism could grow given simple molecules as nutrients. Since thermodynamic entropy has a precise mathematical definition, defining it as simply "disorder" is bound to lead to incorrect conclusions. Misstating the Second Law leads to further errors.

Fortunately, the real Second Law of Thermodynamics in no way forbids local decreases in entropy as long as energy or matter is released to the surroundings to increase the net thermodynamic entropy of the Universe as a whole. For example, the energy released to the surroundings when ice forms "pays" for the decreased thermodynamic entropy of the ice. Those creationists who understand this aspect of the Second Law will still often refuse to give up the argument by bringing up the fact that adding heat to a squashed bug in a test tube will not cause the bug to re-assemble. They claim that adding energy to the bug guts is insufficient to get a local decrease in thermodynamic entropy in the form of bug resurrection. Surprise, surprise. From a thermodynamic standpoint, trying to form ice by heating water is equally absurd. However, they use the bug example to introduce an additional confusion -- the idea that intelligently programmed information is somehow a necessary condition for local decreases in thermodynamic entropy in biological systems. While it is true that local decreases in thermodynamic entropy require the proper conditions in addition to energy and/or matter exchanges with the surroundings, trying to invoke the need for information with the bug example is pointless. The Second Law of Thermodynamics says nothing about information being a necessary condition to get local decreases in thermodynamic entropy under any circumstances. Information theory is a completely separate realm from thermodynamics. The presence of intelligently programmed information is clearly not necessary for ice formation, for example. (Note: In thermodynamics, the technical term for something that exchanges energy and/or matter with the surroundings is an "open system." The energy and matter can go in or out in an open system. Animals are open systems because they take in energy in the form of food, radiate heat to the surrounding, breathe air, and produce wastes.)

In the end, the Second Law dictates that energy must be expended or released under the right conditions to put complex molecules together from simpler ones. Again, the Second Law says nothing about the need for information for this to occur. The Second Law also dictates that organisms that cease taking in energy and cease releasing wastes will, at best, be in stasis or, more likely, die and deteriorate because energy will become increasingly unavailable in such closed systems. As long as organisms eat and breathe, however, no aspect of their existence, including their evolution, will not violate the Second Law of Thermodynamics.

But what about this idea of information then? If the Second Law of Thermodynamics says nothing about information, obviously information theory has a lot to say about it. Does evolution, the idea that organisms can become more complex over succeeding generations, violate information theory? The short answer is "no." For the long answer, keep reading.

One of the reasons I kept using the perhaps annoying phrase "thermodynamic entropy" in the above discussion of the Second Law of Thermodynamics is that "entropy" shows up in information theory as well. However, "informational entropy" and "thermodynamic entropy" are not analogs. Temperature is an important aspect of thermodynamics, but there is nothing comparable to temperature in information theory (Yockey, 1992). Thus one should keep the concept of entropy in thermodynamics separate from the quantity known as "entropy" in information theory. About the only thing "thermodynamic entropy" and "informational entropy" have in common is that they both have a tendency to increase. (Although, as we have discussed, thermodynamic entropy can decrease locally under the right conditions.)

I will define informational entropy as the complexity of the message. the complexity of the message.

The one other thing informational entropy has in common with thermodynamic entropy is that informational entropy has a precise mathematical definition. Information itself also has a precise mathematical definition in information theory. Defining informational entropy and information content in words can lead to inaccuracies and incorrect conclusions, especially when a layman's understandings of the familiar terms information and meaning creep into the discussion. However, a reasonable definition of information content can be described as "a measure of the informational entropy of a message." I will define informational entropy as the complexity of the message. More precisely, the informational entropy or information content of a message can be described as the minimum number of instructions needed to describe the message with certainty. This definition approximates the idea of the Kolmogorov-Chaitin algorithmic entropy of a message (see Yockey, 1992).

Let's look at some examples.

The string of bits:

010101010101010101

has low informational entropy. While you could say the string is 20 bits long and say that is its information content, the definition I will use says that the information content is low for the sequence because the sequence can be described as a simple instruction such as

• Repeat "01" 10 times

In other words, this highly ordered sequence is simple rather than complex. On the other hand, if we look at 20 random bits:

01011010101000111001

the complexity of the message is greater. The information content, as determined by the Kolmogorov-Chaitin algorithmic entropy is higher. In other words, it takes a longer instruction set to describe the bit sequence:

1. Repeat "01" 2 times.
   
2. Repeat "10" 4 times.
   
3. Repeat "0" 2 times.
   
4. Repeat "1" 3 times.
   
5. Repeat "0" 2 times.
   
6. Repeat "1" 1 time.

The above example shows us an interesting consequence of information theory. Namely, a random sequence is complex. Thus information theory can tell us nothing about whether a complex sequence was designed or generated by random chance (Yockey, 1992). Claims that complex DNA sequences are evidence of intelligent design are therefore false.

So what does this have to do with evolution? The more astute readers have probably already guessed. It turns out that random mutations can increase the complexity of a sequence and thus the information content in DNA. The repetitive sequence:

ATATATATATATATATATAT

has low informational entropy and therefore low information content since it could be described by a single instruction:

• 1. Repeat "AT" 10 times.

A single point mutation increases the complexity of the sequence and thus its information content as defined by information theory because more instructions would be required to describe the following mutated sequence:

ATATACATATATATATATAT

• Repeat "AT" 2 times.
  
• Repeat "AC" 1 time.
  
• Repeat "AT" 7 times.

If we duplicate the first DNA sequence I gave, the information content does not really increase. We could just specify a different number of repeats in the one instruction line. However, duplicating the second DNA sequence clearly would require more instructions to specify the new, longer sequence with certainty. Thus duplicating a DNA sequence that is anything other than a simple repetitive sequence means an increase in the total complexity of the message. The information content as defined by information theory clearly goes up. To emphasize this, look at a duplication of the second sequence:

ATATACATATATATATATATATATACATATATATATATAT

The instruction set for this 40 nucleotide sequence is larger than the instruction set for the 20 nucleotide sequence from which it was derived:

• Repeat "AT" 2 times.
  
• Repeat "AC" 1 time.
  
• Repeat "AT" 9 times.
  
• Repeat "AC" 1 time.
  
• Repeat "AT" 7 times.

Alternatively, the instruction set could be expressed something like the following:

• Repeat "AT" 2 times.
  
• Repeat "AC" 1 time.
  
• Repeat "AT" 7 times.
  
• Repeat Steps 1-3.

In either case, the longer sequence takes more instructions to specify and therefore is more complex as determined by the Kolmogorov-Chaitin algorithmic entropy. Thus its information content is higher. The creationist objection that duplications "do not add anything new" is based on a lay understanding of information rather than the rigorous definitions of information theory. Their objection amounts to incredulity and is therefore meaningless. The same can be said of creationist objections about any other mutation. If the mutation increases the complexity of the message (as determined by the minimum set of instructions needed to specify the message) then information increases according to the definitions of information theory. Personal incredulity and lay understandings of information do not change that fact.

Since gene duplications are known to occur, the information content of a genome can increase as a result. Point mutations in the duplicated or original sequence have the potential of further increasing the complexity of the DNA sequence and thus its information content. Since information theory says that informational entropy tends to increase in a communication system that is prone to errors (Yockey, 1992), the increasing complexity of genomes over succeeding generations is inevitable. Thus the evolution of increasingly complex organisms seems an unavoidable consequence of information theory. This should be even more apparent when one realizes that it is not just structural genes that will become more complex. The genes that regulate body plans can also be duplicated and changed. Thus diversity of form is inevitable. One thing moderating this increasing complexity is natural selection. If a new, more complex genome is less fit, the inheritors of that new, more complex genome will die off and the organisms that inherit no mutations, fewer mutations, or different mutations will flourish. On the other hand, if the inheritors of the new, more complex genome are more fit in the old environment or in some new environment they chance upon, then they will prosper and the increased complexity will be passed on with the potential for further increases in subsequent generations. For a more technical and in depth discussion of informational entropy and evolution, I recommend Brooks (1984).

In case the implications of the above background in information theory are unclear, let's look at a two examples of mutations that produced increases in the information content of the DNA of organisms. I have chosen the examples I did because not only does information content as defined by information theory increase, but the increases in information content also resulted in a benefit for the inheritors of that increased information. Though some might consider the examples modest, they illustrate that information content and complexity can increase over generations and that benefits can result from this. This is all that is required to demonstrate the plausibility of evolution and to show that the creationist assertions that information contents can only decrease and that mutations cannot produce benefits or new information are false.

Example 1: Gene duplications in yeast leading to more fit progeny.

Brown et al. (1998) reported that a population of baker's yeast grown in a glucose limiting environment for a few hundred generations spontaneously produced mutant offspring. The mutant offspring were better able to take up the glucose from the low-glucose environment. The offspring were found to have duplications of two different sugar transport protein genes. Furthermore, there were more than three new genes formed from the control region of one of the sugar transport genes with the coding region of the second. Finally, the mutant offspring were able to out-compete individuals of the ancestral population in pair-wise competition experiments.

This really is a great example of an information-increasing mutation leading to progressive evolution. The new genes, combinations of a control region of one gene with the coding region of another, represent new information as determined by the Kolmogorov-Chaitin algorithmic entropy measure. The objection a creationist might raise that nothing "new" was created since both genes were already there and all you have is a combination of redundant information is irrelevant. It is indeed a new combination that did not exist before that increases the complexity of the yeast genome. The information content of the genome is increased according to the rigorous definitions of information theory. Creationists going all out in an incredulity argument would probably say "well, it's still a yeast" or "the yeast didn't sprout legs or anything really new." These fail for the reason the first objection fails. Creationists can still console themselves that the evolution of new features that even they could not deny takes much longer than a lifetime, so it probably will never be shown directly in a laboratory experiment that, for instance, an organism can go from "no legs" to "fully functional legs." However, this experiment demonstrates that complexity-increasing and information-increasing beneficial mutations do exist. The association of changes in the fossil record with such mutations is therefore a solid scientific inference rather than a religious leap of faith.

Example 2: Spontaneous tandem duplications in a pseudorevertants

This is really three related examples in one. Akanuma et al. (1996) were working with a bacteria that can normally grow at temperatures up to 85 degrees Celsius. They had a mutant that was thermally sensitive due to the deletion of 22 nucleotides in a gene coding for a protein involved in the synthesis of leucine, an amino acid. After growing the mutant strain under strong selective pressure (i.e. temperatures where the mutant could barely grow), the researches isolated three strains of that had improved growth at high temperature. The new strains differed from the wild-type bacteria from which the mutant was derived, hence the term "pseudorevertant." (A true revertant would have the same genotype as the wild-type organism). The three pseudorevertants all showed duplications of just part of the gene that added 6 to 21 nucleotides to the gene. The proteins coded for by these new mutant genes, which were longer and more complex in the informational entropy sense, also had improved catalytic activity in addition to improved thermal stability over the protein in the thermally-sensitive strain from which the pseudorevertants descended. Thus three different mutations, all increasing the information content of the genomes, produced more stable and efficient proteins.

Conclusion
Contrary to creationist contentions, evolution does not violate the Second Law of Thermodynamics or information theory. The evolution of organisms does not violate the Second Law of Thermodynamics any more than the growth of individual organisms violates the Second Law. The creationist contention that intelligent information in DNA somehow gets around the Second Law is erroneous. The only requirement for localized decreases in thermodynamic entropy that accompany protein synthesis or organism growth is the requirement for an open system. Organisms are open thermodynamic systems as long as they eat and breathe.

The real connection between entropy and evolution comes from looking at information theory. The kind of entropy that is important to evolution is informational entropy. Like thermodynamic entropy on a universal scale, informational entropy tends to increase over time. Since an increase in informational entropy means the complexity of a message increases, the message transmitted by DNA over generations increases in complexity. The organisms specified by the message will be more complex as a result. Evolution thus seems to be an inevitable consequence of the properties of information. Selection provides a filter that determines which of the more complex messages survive. Illustrating these trends are examples of organisms that, under specific selective pressures, experience partial or complete duplications of genes that lead to increased information content of genomes, enhanced fitness, and improved proteins. While these examples may not be as dramatic as creationists demand in asking for the "proof" of evolution that they don't really want in any case, the examples at least falsify the creationist contentions that information-increasing beneficial mutations do not exist.

References

• * Akanuma, S., Yamagishi, A, Tanaka, N., and Oshima, T. (1996) J. Bacteriol. 178:6300-6304
  * Brooks, D. R., Leblond, P. H., and Cumming, D. D. (1984) J. Theor. Biol. 109:77-93.
  * Brown, C. J., Todd, K. M., and Rosenzweig R., F. (1998) Mol. Biol. Evol. 15(8):931-42.
  * Yockey, H. P. (1992) Information Theory and Molecular Biology. Cambridge: Cambridge University Press.

---

I know I have not given many details, but I wanted to see if there would be a response and what direction the discussion would follow. I look forward to what you have to say.

You've given enough to reveal your true colours ... what was it you said in your Intro? "Its the first time I've ever used something like this, but I'm a quick learner." ... apparently either you're not that quick or the creationist definition of "quick" is as whacky as their definition of evolution.

Kyu

[Samson]

Honestly I am quite skeptical of macro evolution (not micro) myself

One thing you need to keep in mind Senseiotho, is that that the term, "Micro/Macro" is not used in Scientific community/Circles on a normal basis....The creationist are the ones who have separated this for their own uneducated agendas, and of course the, so called, Scientist who consider themselves creationist. (And I use the term Scientist very loosely)...

[SenseiOtho]

LukeMC
Thanks for a honest answer of the reality that science does not have all the answers. I respect that even though we disagree on what the implications of the current evidence shows. There are actually some things that are outside the realm of science. As for the websites they were interesting especially the one on the eye. Though it seems to be a fallacious jump from "I noticed that the shape of the cells in the worm’s brain resembled the rods and cones in the human eye" to look at the similarities in this molecule to this is "concrete evidence of common evolutionary origin". Wouldn't similarities be expected if they are serving similar functions? I'm also wondering why this wasn't reported on more if it really has such significance (I know you can't really answer that one, your not the news agencies. Its just a question I was wondering). Regardless, the scientist were assuming evolution is true, as does the test itself, then when they find a similarity its no surprise that it means they are common ancestors. It also never mentioned what about all the other molecules that were examined and if they were similar. I would be interested in finding out how many other molecules were dissimilar, so we would have an idea of if the data was "cherry picked". Anyway, it was interesting yet overall I felt it overreached in its conclusion. Maybe I just don't understand the significance of the "molecular fingerprints."

As for the Flagellum the only thing I hadn't heard before was the idea of the "parts" of a IC system being the individual proteins and not the whole piece, such as the paddle, rotor, etc. While this is interesting and at first glance seems that it might undercut IC, I realized that it seems to cause even more problems for the evolutionist. Because now you have to account for every amino acid in a protein, not just the proteins themselves and their structure in a system. Questions like: how the DNA was mutated to allow its creation, redeployment, how would adding an amino acid randomly here or there actually improve the system/protien and not hinder it. What stops the "new" proteins from being incompatable with the existing system. What improvement would adding single amino acids and changing proteins around have on the cell for its survival. I could go on, but hopefully you get the picture. It does raise a good question though of the need to scientifically and clearly identify what is the irreducibly complex parts of the system being examined. If you want me to comment on something specific just let me know.

When you consider all options, is it really more likely that some onmipotent being fiddled with our DNA at random intervals while purposefully leading us towards the worldwide hostility and suffering we see to today- just because we can't explain our eyes fully at this present moment?

- this is a good question, but it is not a scientific question, so I don't want to get side tracked in this post, but there are many other questions that go into it. Such as, did some omnipotent being actually fiddle with DNA at random intervals, or where things created/designed in a certain way, even designed to evolve needs to be asked. Also is there a such thing as "sin/evil" and what its effects would be on the world. My belief in God and Jesus is not dependent on if evolution is true or not, true I might need to reinterpret certain passages, but there is room for other interpretations if evolution was proven correct. I have very little to lose, but it seems like for the Atheist, that your entire worldview would be turned upside down if evolution was shown to be false and there were some type of omnipotent being. I have no problem saying that intelligence and/or natural causes are at work, but for the atheist/materialist it seems that intelligent causes are thrown out a priori.

I'll probably comment more on the information later since "the angry atheist" commented on it....

[SenseiOtho]

One thing you need to keep in mind Senseiotho, is that that the term, "Micro/Macro" is not used in Scientific community/Circles on a normal basis....The creationist are the ones who have separated this for their own uneducated agendas, and of course the, so called, Scientist who consider themselves creationist. (And I use the term Scientist very loosely)...

    Just a note to clarify about "uneducated agendas."  It was the Russian Entomologist Yuri Filipchenko who coined the terms "macroevolution" and "microevolution" in 1927 in his German language work, "Variabilität und Variation." That is how it attained its modern usage. The term was later brought into the English-speaking world by the neo-darwinist Theodosius Dobzhansky in his book "Genetics and the Origin of Species" (1937). Dobzhansky actually worked with Filipchenkowas and Dobzhansky was a very influential and prolific evolutionist.
     Creationists did not coin the terms or the distinction with their "uneducated agendas." It is a helpful distinction created by evolutionists between what has been verified scientifically and what is still speculation or assumption (I can give you his quote if you would like). I was using the term because I find it a helpful distinction as well, even though I know that some modern evolutionists are trying to get rid of the terms and the distinction. Though it seems like a PR campaign to gloss over the actual difficulties of macro-evolution and let its truth value ride on the evidence for micro-evolution. Webster still defines them as changes below the species level (micro) and major changes such as species formation (macro). This is how I was basically using them.  But, I will try to use the terms adaptation and speciation if that is the scientific norm now, since they are basically the same. Though I don't know if speciation normally covers the emergence of new organs and body types. I guess generally speaking it would "given enough time".

[Tiberius]

I am fine with microevolution and macroevolution, just as long as people understand that microevolution implies macroevolution. To get macroevolution, all you need is a number of mutations that result in the organism being unable to breed with other variations of its ancestors. Since we already have a number of mutations being produced through microevolution, macroevolution is not just possible, but is observed.

[Darwinian]

I think that accepting microevolution but not macro is a bit like saying that a few raindrops can make a puddle but for a lake, you require divine intervention.

[Tiberius]

I think that accepting microevolution but not macro is a bit like saying that a few raindrops can make a puddle but for a lake, you require divine intervention.

Or that you cannot walk a mile by taking one step at a time.

[SenseiOtho]

Adaptation (what you creationists would have us call micro-evolution so that you can accept what evidence shows is happening while denying the possibility of speciation) is change, adaptation occurs all the time and as anyone (any 5 year old I imagine) could tell you one plus one equals two, something small plus something small equals something bigger. So it is with change ... small change plus small change plus small change plus small change plus (ad infinitum) results in much larger change, IOW adaptation (which even creationists, through the sheer hammering home of evidence, have been forced to admit occurs) happens and adaptation across sufficient time results in speciation. Change at the species level (given the currently accepted age of the Earth and the forces acting in the environment) is pretty much inevitable, new species will arise ...

interesting trying to switch the argument around on the non-evolutionist to show what keeps species stable. I still think the burden of proof lies on the evolutionist to show how drastic changes happen and if little change after little change can overcome stabilizing factors in life. It seems to be that Mendelian genetics within populations, the extreme rarity of beneficial mutation along with the problems of gene fixing, as well as gene self-regulating and repairing tends to keep life basically the same. Even in the era of modern research on the fruit fly and bacteria, we still find that there are limits to the change, with almost all changes being harmful or at best neutral. Even with bacterial drug resistance which is the only helpful change I know of, it still comes with a high cost. What's interesting yet rarely reported is that those resistant bacteria when placed back with the parent culture without the drug can't keep up reproductively, which means that natural selection would weed them out and there was no net gain. Only in specific extreme environments would they be dominate, and that's what we find in extreme temperatures and acidity environments (or hospitals). But not surprisingly they are still bacteria.

The fossil record gives plenty of evidence for the stability of life. It shows that the vast majority of animals appear suddenly and live for long periods of time with little change, then most go extinct pretty much how they appeared. I think there are a handful of fossils claimed to be transitional, yet even these are plagued with problems in showing that they are actually transitional and not just assumed to be due to some similarity in their bones. The "living fossils" that have been found when studied have been huge let downs. One such example is the coelacanth (walking fish transitional fossil) that supposedly went extinct 65 million years ago, but when found alive and studied they actually swim with those fins and don't walk with them. As I said the burden of proof is still on the evolutionist.

I guess technically you could say there has been speciation if you define a species as a reproductively isolated population, which is one (of about 5?) of the common definition in scientific research, but this just shows that two bird populations (for example) don't naturally reproduce in the wild. Many times they still can in captivity (a popular non-bird example being the lion and tiger = the liger), plus it doesn't show any new forms or changes in the higher levels above the species which is really where evolution must explain. The different species still have wings and beaks, their bones are still hollow and made for flying, they still lay eggs, etc. Not to mention that this definition of species leaves out the fossil record and any asexual reproducing life. I'm ok with this type of reproductive speciation by the way, because it is still limited and doesn't account for the massive variety between phyla, at least the actual evidence doesn't show that it does.

--as for the walking or rain drop analogy, the basic assumption of evolutionist seem to be that there is nothing working against change or regulating change within limits. As I've stated above this seems to be a bad assumption based on the evidence around us. One drop at a time doesn't make a lake if the sun is drying it up or the earth soaking it up. We do see puddles formed naturally and regularly under these conditions, lakes require more conditions than just rain. And you can't take one step at a time to get a mile away if the grand canyon is between the start and end.

kyu I'll answer some of your other objections later, but I'm still interested in if you have an answer to the problem of the Cambrian explosion, you waved it off in your last post and so I'm not sure if your conceding the point that it is a dilemma for evolution or just didn't have time to answer it.

[Tiberius]

What is the problem with the Cambrian explosion?

[Kyuuketsuki]

Adaptation (what you creationists would have us call micro-evolution so that you can accept what evidence shows is happening while denying the possibility of speciation) is change, adaptation occurs all the time and as anyone (any 5 year old I imagine) could tell you one plus one equals two, something small plus something small equals something bigger. So it is with change ... small change plus small change plus small change plus small change plus (ad infinitum) results in much larger change, IOW adaptation (which even creationists, through the sheer hammering home of evidence, have been forced to admit occurs) happens and adaptation across sufficient time results in speciation. Change at the species level (given the currently accepted age of the Earth and the forces acting in the environment) is pretty much inevitable, new species will arise ...

Interesting trying to switch the argument around on the non-evolutionist to show what keeps species stable. I still think the burden of proof lies on the evolutionist to show how drastic changes happen and if little change after little change can overcome stabilizing factors in life. It seems to be that Mendelian genetics within populations, the extreme rarity of beneficial mutation along with the problems of gene fixing, as well as gene self-regulating and repairing tends to keep life basically the same. Even in the era of modern research on the fruit fly and bacteria, we still find that there are limits to the change, with almost all changes being harmful or at best neutral. Even with bacterial drug resistance which is the only helpful change I know of, it still comes with a high cost. What's interesting yet rarely reported is that those resistant bacteria when placed back with the parent culture without the drug can't keep up reproductively, which means that natural selection would weed them out and there was no net gain. Only in specific extreme environments would they be dominate, and that's what we find in extreme temperatures and acidity environments (or hospitals). But not surprisingly they are still bacteria.

Do you? Unfortunately for you just about the entire scientific community (and all of the relevant experts) accept evolution so actually it is YOU that has to supply reasonable evidence that the theory of evolution isn't what happens. The advent of entirely novel species has been documented and given that no serious evolutionary scientist expects new species to be popping up every week (speciation is really a rather rare event when considered on a human timescale) those that have been shown are simply additional evidence that the theory evolution does explain the diversity of life we see around us.

What's really interesting is that you utterly failed to answer my question.

The fossil record gives plenty of evidence for the stability of life. It shows that the vast majority of animals appear suddenly and live for long periods of time with little change, then most go extinct pretty much how they appeared. I think there are a handful of fossils claimed to be transitional, yet even these are plagued with problems in showing that they are actually transitional and not just assumed to be due to some similarity in their bones. The "living fossils" that have been found when studied have been huge let downs. One such example is the coelacanth (walking fish transitional fossil) that supposedly went extinct 65 million years ago, but when found alive and studied they actually swim with those fins and don't walk with them. As I said the burden of proof is still on the evolutionist.

Sigh! Do you really want to talk transitional fossils?

I know you're a creationist so let me try and explain this simply for you ...

Consider your mother and father. The three of you are very different morphologically and, in genetic terms, the differences between you are immense. What is the reason for this difference? The reason, quite simply, is that you are a product of your mother and your father with enough additional variation thrown-in to make you an individual. Now consider yourself again in comparison with some of the races that exist around the world. Some of them are "white", some are "yellow", some are "red", some are "brown", and some are "black", some have red hair, some have black hair, some have blond hair, some have "blue" eyes, some have "brown" eyes and some have "green" eyes. Some are short, some are tall, some are thin and some are fat. Some have heritable conditions such as deafness, cancer resistance, optical problems, ankylosing spondylitis and many, many more non-fatal "genetic flaws". Yet these are only (some of) the most easily discernible characteristics ... there's blood groups, various hereditary disease and I haven't even started on biochemical & protein differences. Yet, despite the immense level of morphological variation within & between these individuals races, they are all classified as human ... strange that!

You see the classification of a species is not something that was built into nature, the classification is manmade in order to allow us to deal with these animals on an objective basis ... genetic & morphological variation cover an immense range, even within a single species.

Assume for a moment, that a species exists within some hypothetical environment and that within that it moves to a different environment or that environment is changed around it. According to the theory of evolution that species will begin to adapt and change to the new environment and successive generations will keep changing until, at some non-specified point, that species is no longer the species that we started with but another. So at what point does species A become species B? Quite simply when it ceases being species A.

It is important to understand that it is only with hindsight that we realise that any given species has mutated to another. We note Species A and through observation define it. We note Species B and through observation define it as well. We note and define more species and construct a possible chain through which they might have evolved ... later evidence and predictions confirm that this chain of evolution is possible even highly likely. But though this chain is very complete we "know" that there must have been change between them and therefore whatever it was in the middle of that chain is what we refer to as a transitional. Now species (as we see from above) are not the some fixed biological entity that is laid down in a textbook it is general type of animal covering a relatively broad range of biologically similar animals. And the typical view is that transitionals are simply animals that we are unable (for various reasons) to conveniently classify into one given species or another (actually all end-branch species such as humans are transitional but I'll deal with that in a later post).

The reason that your evangelical leaders make the kind of claim you do (that evolution does not work, that new species do not arise) is because it is convenient fopr them to do so. In order to defeat those aspects of science they find unacceptable they simply take an accepted scientific definition or explanation and redefine it to a creationist version of that definition or explanation. Then they destroy those definitions and explanations in a manner that can easily persuade those of lesser scientific knowledge without making it clear to their potential convert's that they are not actually destroying any known scientific theory at all.

With specific reference to transitionals, you creationists would have us believe that transitionals start at the moment the first change is introduced but that cannot be so … if it were every single animal and person on this planet would be of a different species. Transitionals for reasons of fossilisation and poor creationist understanding of science are not as common as you would like to believe they are.

Robert Tague and Owen Lovejoy of Kent State University addressed this issue by reconstructing the obstetrics of Lucy, the well-preserved female skeleton that belongs to Australopithecus-afarenesis. They concluded that her pelvic inlet, the skeletal portal for the birth canal, would have allowed her to give birth to a baby no larger than a newborn male chimp or orangutan. Like all primates, Lucy's new baby would have resembled these newborn apes in having a brain that constituted about 10% of its total weight.

As for Lucy herself: Even the hind limb of Australopithecus though adapted for walking and running on the ground, retained traits that would also have made it superior to modern humans as a climber. The toes were more curved than ours and longer for length of the leg. Also the long curved finger bones would have been useful for curling around the branch of a tree or for gripping its trunk. And there is the fact that all humans on the earth can directly trace their DNA back to Lucy (or a close ancestor of). Since that time, when man was in one its transitional stages, we have evolved since then. We no longer have curved finger bones and other limbs designed for climbing trees.

I guess technically you could say there has been speciation if you define a species as a reproductively isolated population, which is one of the common definitions in scientific research, but this just shows that two bird populations (for example) don't naturally reproduce in the wild. Many times they still can in captivity (a popular non-bird example being the lion and tiger = the liger), plus it doesn't show any new forms or changes in the higher levels above the species which is really where evolution must explain. The different species still have wings and beaks, their bones are still hollow and made for flying, they still lay eggs, etc. Not to mention that this definition of species leaves out the fossil record and any asexual reproducing life. I'm OK with this type of reproductive speciation by the way, because it is still limited and doesn't account for the massive variety between phyla, at least the actual evidence doesn't show that it does.

You realise don't you, the massive time scales involved in evolution? You realise that observing the fossil record gives clear evidence supporting an obvious tendency for more recent fossils to resemble modern species, chains or branches connecting primitive genera with modern radically different ones and a lot of gaps entirely expected by the theory?

Not trying to be funny here but as far as I can tell you're just letting your religious beliefs suborn your intellectual ability7.

I'm still interested in if you have an answer to the problem of the Cambrian explosion, you waved it off in your last post and so I'm not sure if your conceding the point that it is a dilemma for evolution or just didn't have time to answer it.

There are fossils of complex organisms originating from tens of millions of years before the Cambrian, some of which are obvious precursors to Cambrian animals, and smaller fossils are found from hundreds of million of years before. The 'explosion' lasted for tens of millions of years, which is only brief by geological standards. The Cambrian actually shows animal groups appearing over many millions of years in forms very different than they appear today.

Kyu